Skip to main content
Addgene

pLKO5.U6.DR130(CasRX)_Non-targeting sgRNA.EFS.tRFP657
(Plasmid #212962)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 212962 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLKO.005
  • Total vector size (bp) 7361
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    TagRFP657

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DR1_CasRx_non-targeting spacer
  • Promoter U6
  • Tag / Fusion Protein
    • TagRFP657

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer ACGATACAAGGCTGTTAGAGAG
  • 3′ sequencing primer N/A
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO5.U6.DR130(CasRX)_Non-targeting sgRNA.EFS.tRFP657 was a gift from Roland Rad (Addgene plasmid # 212962 ; http://n2t.net/addgene:212962 ; RRID:Addgene_212962)

  • For your References section:

    Genome-scale pan-cancer interrogation of lncRNA dependencies using CasRx. Montero JJ, Trozzo R, Sugden M, Ollinger R, Belka A, Zhigalova E, Waetzig P, Engleitner T, Schmidt-Supprian M, Saur D, Rad R. Nat Methods. 2024 Feb 26. doi: 10.1038/s41592-024-02190-0. 10.1038/s41592-024-02190-0 PubMed 38409225
Related items:
Commonly requested with: