Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGorilla-AAVS1-TetOn-ZIM3-KRAB-dCas9-P2A-mCherry
(Plasmid #212831)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 212831 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGorilla-AAVS1-TetOn-ZIM3-KRAB-dCas9-P2A-mCherry
  • Total vector size (bp) 14075
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ZIM3-KRAB-dCas9-P2A-mCherry
  • Alt name
    dCas9
  • Species
    Synthetic
  • Insert Size (bp)
    10705
  • Promoter CAG, TetOn
  • Tags / Fusion Proteins
    • HA-tag (C terminal on insert)
    • ZIM3-KRAB (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer ATGGCCGATCCCATGGTGGCGGTAC
  • 3′ sequencing primer GGTGGCGATCCCGGGCCCGCGGTAC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGorilla-AAVS1-TetOn-ZIM3-KRAB-dCas9-P2A-mCherry was a gift from Wolfgang Enard (Addgene plasmid # 212831 ; http://n2t.net/addgene:212831 ; RRID:Addgene_212831)
  • For your References section:

    Generation and characterization of inducible KRAB-dCas9 iPSCs from primates for cross-species CRISPRi. Edenhofer F. C., Térmeg A., Ohnuki M., Jocher J., Kliesmete Z., Briem E., Hellmann I., Enard W.. iScience, 21 June 2024 10.1016/j.isci.2024.110090