pCyno-AAVS1-TetOn-ZIM3-KRAB-dCas9-P2A-mCherry
(Plasmid
#212830)
-
PurposeDoxycycline-inducible (Zim3)KRAB-dCas9-HA-P2A-mCherry cassette for integration at the AAVS1-locus of the cynomolgus genome.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 212830 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCyno-AAVS1-TetOn-ZIM3-KRAB-dCas9-P2A-mCherry
- Total vector size (bp) 14058
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameZIM3-KRAB-dCas9-P2A-mCherry
-
Alt namedCas9
-
SpeciesSynthetic
-
Insert Size (bp)10710
- Promoter CAG, TetOn
-
Tags
/ Fusion Proteins
- HA-tag (C terminal on insert)
- ZIM3-KRAB (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer AGACTTCCTCTGCCCTCTCC
- 3′ sequencing primer GGGAATTGTTCATGGTGGCGCGCGTAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCyno-AAVS1-TetOn-ZIM3-KRAB-dCas9-P2A-mCherry was a gift from Wolfgang Enard (Addgene plasmid # 212830 ; http://n2t.net/addgene:212830 ; RRID:Addgene_212830) -
For your References section:
Generation and characterization of inducible KRAB-dCas9 iPSCs from primates for cross-species CRISPRi. Edenhofer F. C., Térmeg A., Ohnuki M., Jocher J., Kliesmete Z., Briem E., Hellmann I., Enard W.. iScience, 21 June 2024 10.1016/j.isci.2024.110090