qMaLioffG
(Plasmid
#212825)
-
Purposegreen fluorescent FLIM indicator for endogenous ATP imaging
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 212825 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1(-)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameqMaLioffG
-
Insert Size (bp)1128
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.08.29.555275 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
qMaLioffG was a gift from Tetsuya Kitaguchi (Addgene plasmid # 212825 ; http://n2t.net/addgene:212825 ; RRID:Addgene_212825) -
For your References section:
qMaLioffG: A single green fluorescent protein FLIM indicator enabling quantitative imaging of endogenous ATP. Arai S, Itoh H, Vu CQ, Nakayama M, Oshima M, Morita A, Okamoto K, Okuda S, Teranishi A, Osawa M, Tamura Y, Nonoyama S, Takuma M, Fujie T, Sarker SR, Sudhaharan T, Kiya T, Lane EB, Kitaguchi T. bioRxiv 2023.08.29.555275 10.1101/2023.08.29.555275