pPB_EF1a_Gag∆MA
(Plasmid
#212654)
-
PurposepiggyBac vector to express MLV Gag with truncated MA domain
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 212654 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepB-rtTA (Addgene #126034)
-
Vector typeMammalian Expression ; piggyBac
-
Selectable markersmNeon
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMLV Gag (UniProt ID: P03332)
-
SpeciesMoMLV
-
MutationDeletion of MA domain (amino acids 2-215)
-
Entrez Genegag (a.k.a. MLVgp8)
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcgatggagtttccccacactg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe MLV Gag ORF was cloned from MLV Gag-YFP (Addgene Plasmid #1813, a gift from Walther Mothes)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPB_EF1a_Gag∆MA was a gift from Paul Blainey (Addgene plasmid # 212654 ; http://n2t.net/addgene:212654 ; RRID:Addgene_212654) -
For your References section:
Live-cell transcriptomics with engineered virus-like particles. Najia, M. A., Borrajo, J., Le, A., Tsai, F., Huang, J. Y., Griffith, L. G., Daley, G. Q., & Blainey, P. C.. bioRxiv. 10.1101/2024.10.01.616098