pPB_EF1a_mNeon
(Plasmid
#212653)
-
PurposepiggyBac vector to express mNeon
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 212653 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepB-rtTA (Addgene #126034)
-
Vector typeMammalian Expression ; piggyBac
-
Selectable markersmNeon
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemNeon
-
SpeciesSynthetic
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcgatggagtttccccacactg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPB_EF1a_mNeon was a gift from Paul Blainey (Addgene plasmid # 212653 ; http://n2t.net/addgene:212653 ; RRID:Addgene_212653) -
For your References section:
Live-cell transcriptomics with engineered virus-like particles. Najia, M. A., Borrajo, J., Le, A., Tsai, F., Huang, J. Y., Griffith, L. G., Daley, G. Q., & Blainey, P. C.. bioRxiv. 10.1101/2024.10.01.616098