pSCALPS-Flag-Mili-EGFP
(Plasmid #212576)

• Purpose: Lentiviral expression of Flag-tagged mouse Mili in mammalian cells
• Depositing Lab: Phillip Zamore
• Publication: Arif et al Nature. 2022 Aug;608(7923):618-625. doi: 10.1038/s41586-022-05009-0. Epub 2022 Jun 30.

Backbone

• Vector backbone: pSCALPS
• Backbone size w/o insert (bp): 7743
• Total vector size (bp): 12615
• Modifications to backbone: EGFP added in frame of insert
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Mili
• Alt name: Piwil2
• Species: M. musculus (mouse)
• Insert Size (bp): 3629
• GenBank ID: NM_001364321
• Entrez Gene: Piwil2 (a.k.a. Piwil1l, mili)
• Promoter: SFFV
• Tags / Fusion Proteins:
  • 5x Flag (N terminal on insert)
  • SNAP tag (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGGCCAAGAACAGATGGTCC
• 3′ sequencing primer: CAACGAGAAGCGCGATCACATG

Resource Information

• Supplemental Documents:
  • pSCALPS-Mili-12.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry