Skip to main content
Addgene

pET29-bdSUMO-Anti-ALFA nanobody
(Plasmid #212311)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 212311 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET29
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    anti-ALFA nanobody
  • Species
    Vicugna pacos
  • Promoter T7
  • Tag / Fusion Protein
    • bdSUMO (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CTAGTTATTGCTCAGCGGT
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET29-bdSUMO-Anti-ALFA nanobody was a gift from Arthur Laganowsky (Addgene plasmid # 212311 ; http://n2t.net/addgene:212311 ; RRID:Addgene_212311)

  • For your References section:

    Grafting the ALFA tag for structural studies of aquaporin Z. Stover L, Bahramimoghaddam H, Wang L, Schrecke S, Yadav GP, Zhou M, Laganowsky A. J Struct Biol X. 2024 Feb 2;9:100097. doi: 10.1016/j.yjsbx.2024.100097. eCollection 2024 Jun. 10.1016/j.yjsbx.2024.100097 PubMed 38361954
Related items: