Skip to main content
Addgene

pLX_TRC311/NLS-Cas13d-P2A-Blast
(Plasmid #212196)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 212196 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLX_TRC311
  • Backbone manufacturer
    Genetic Perturbation Platform
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CasRx (NLS-RfxCas13d-NLS)-HA with 2A-Blasticidin
  • Alt name
    Cas13d
  • Species
    H. sapiens (human); Ruminococcus flavefaciens XPD3002
  • Insert Size (bp)
    2994
  • Promoter EF-1α promoter
  • Tags / Fusion Proteins
    • HA (C terminal on insert)
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)
    • blasticidin S deaminase (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NdeI (not destroyed)
  • 5′ sequencing primer ATTCTCAAGCCTCAGACAGTGG
  • 3′ sequencing primer GCCCCTGTTCTCATTTCCG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLX_TRC311/NLS-Cas13d-P2A-Blast was a gift from Stacey Edwards (Addgene plasmid # 212196 ; http://n2t.net/addgene:212196 ; RRID:Addgene_212196)

  • For your References section:

    CRISPR-Cas13d screens identify KILR, a breast cancer risk-associated lncRNA that regulates DNA replication and repair. Wang L, Bitar M, Lu X, Jacquelin S, Nair S, Sivakumaran H, Hillman KM, Kaufmann S, Ziegman R, Casciello F, Gowda H, Rosenbluh J, Edwards SL, French JD. Mol Cancer. 2024 May 15;23(1):101. doi: 10.1186/s12943-024-02021-y. 10.1186/s12943-024-02021-y PubMed 38745269
Related items:
Commonly requested with: