pLX_TRC311/NLS-Cas13d-P2A-Blast
(Plasmid #212196)

• Purpose: CasRx (NLS-RfxCas13d-NLS) with 2A-Blasticidin for RNA targeting. CasRx-2A-Blasticidin is driven by EF1a promoter. EGFP is driven by SV40
• Depositing Lab: Stacey Edwards
• Publication: Wang et al Mol Cancer. 2024 May 15;23(1):101. doi: 10.1186/s12943-024-02021-y.

Backbone

• Vector backbone: pLX_TRC311
• Backbone manufacturer: Genetic Perturbation Platform
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CasRx (NLS-RfxCas13d-NLS)-HA with 2A-Blasticidin
• Alt name: Cas13d
• Species: H. sapiens (human); Ruminococcus flavefaciens XPD3002
• Insert Size (bp): 2994
• Promoter: EF-1α promoter
• Tags / Fusion Proteins:
  • HA (C terminal on insert)
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)
  • blasticidin S deaminase (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NdeI (not destroyed)
• 5′ sequencing primer: ATTCTCAAGCCTCAGACAGTGG
• 3′ sequencing primer: GCCCCTGTTCTCATTTCCG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry