pET28a-HIV p24
(Plasmid
#212195)
-
PurposeBacterial expression plasmid for production of HIV p24 protein with a polyhistidine tag at the N-terminus
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 212195 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepET28a
-
Backbone manufacturerTwist Bioscience
- Total vector size (bp) 5991
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameChain A, Capsid protein p24, HIV type 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)699
-
Tag
/ Fusion Protein
- Polyhistidine (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-HIV p24 was a gift from Richard C. Willson (Addgene plasmid # 212195 ; http://n2t.net/addgene:212195 ; RRID:Addgene_212195)
Map uploaded by the depositor.
