pBK-Ma pylRS nitroY/haloY-F5
(Plasmid #212125)

• Purpose: Expresses Methanomethylophilus alvus pyrrolysine tRNA synthetase engineered for 3-nitroY and 3-haloY under GlnS promoter. Used as a control for Ma Pyl tRNA-synthetase selections.
• Depositing Lab: Ryan Mehl
• Publication: Engineering of Aminoacyl-tRNA synthetase/tRNA pairs for efficient genetic encoding of non-canonical amino acids into proteins. (unpublished)

Backbone

• Vector backbone: pBK
• Backbone size w/o insert (bp): 2012
• Total vector size (bp): 2854
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: M. alvus PylRS 3-NY/HaloY F5
• Alt name: NYF5
• Species: Methanomethylophilus alvus
• Mutation: CTG125CTT, N166A V168S, A223C, W239R
• Promoter: GlnS (constitutive)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: tgctgagttgaaggatcctcgg
• 3′ sequencing primer: gtgaacgccttatccggcctac

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Expresses Methanomethylophilus alvus pyrrolysine tRNA synthetase (MaRS) engineered for 3-nitrotyrosine and 3-halotryosines under GlnS promoter. Used as a control for Ma Pyl tRNA-synthetase selections. This plasmid expresses the Ma RS only and must be paired with a cognate Ma tRNA as well as gene of interest.