pALS3-Ma-sfGFP-TAG150
(Plasmid #212121)

• Purpose: Fluorescence plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses sfGFP-TAG150 and M. alvus Pyl-tRNA(6). p15a origin. Tetracycline resistance.
• Depositing Lab: Ryan Mehl
• Publication: Engineering of Aminoacyl-tRNA synthetase/tRNA pairs for efficient genetic encoding of non-canonical amino acids into proteins. (unpublished)

Backbone

• Vector backbone: pALS3
• Backbone size w/o insert (bp): 4807
• Total vector size (bp): 5551
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Tetracycline, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: sfGFP-150TAG
• Insert Size (bp): 744
• Mutation: N150TAG
• Promoter: araC
• Tag / Fusion Protein:
  • His6 (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NocI (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC

Gene/Insert 2

• Gene/Insert name: M. alvus Pyl-tRNA(6)
• Species: Methanomethylophilus alvus
• Insert Size (bp): 75
• Promoter: lpp

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: TTCTGTTGCCCGTCTCACTG

Resource Information

• Supplemental Documents:
  • Addgene_pALS3-sfGFP-TAG150 Ma pyl-tRNA.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid encodes expression of a) sfGFP with an amber (TAG) codon at N150 and b) Methanomethylophilus alvus tRNA(6). It is to be paired with a plasmid that expresses an M. alvus pyrrolysyl-tRNA synthetase (MaRS). The pALS3 plasmid is used during fluorescence-based selection and characterization of MaRS mutants. It is distinguished from a previous Ma version by containing a tetracycline efflux marker.