pALS3-Ma-sfGFP-WT
(Plasmid #212119)

• Purpose: Fluorescence control plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses sfGFP-WT and M. alvus Pyl-tRNA(6). p15a origin. Tetracycline resistance.
• Depositing Lab: Ryan Mehl
• Publication: Engineering of Aminoacyl-tRNA synthetase/tRNA pairs for efficient genetic encoding of non-canonical amino acids into proteins. (unpublished)

Backbone

• Vector backbone: pALS3
• Backbone size w/o insert (bp): 4807
• Total vector size (bp): 5551
• Modifications to backbone: Tetracycline Resistance Marker Added
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Tetracycline, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: SUMO-sfGFP-WT
• Insert Size (bp): 1026
• Promoter: araC
• Tag / Fusion Protein:
  • His6 (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (unknown if destroyed)
• 3′ cloning site: PstI (unknown if destroyed)
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC

Gene/Insert 2

• Gene/Insert name: M. alvus Pyl-tRNA(6)
• Species: Methanomethylophilus alvus
• Insert Size (bp): 75
• Promoter: lpp

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: TTCTGTTGCCCGTCTCACTGG

Resource Information

• Supplemental Documents:
  • Addgene_pALS3-sfGFP-WT Ma pyl-tRNA.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid encodes expression of a) sfGFP-WT, uninterrupted by TAG codons, and b) Methanomethylophilus alvus tRNA(6). It is to be paired with a plasmid that expresses M. alvus pyrrolysyl-tRNA synthetase (MaRS). This control plasmid is used during fluorescence-based selection and characterization of one or more MaRS mutants. It is distinguished from a previous Ma version by containing a tetracycline efflux marker.