pAC150-KEIMA-VAPA
(Plasmid
#212096)
-
PurposeFluorescent reporter for VAPA clearance to acidic lysosomes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 212096 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAC150-PBLHL-4xHS-EF1a-DEST
-
Backbone manufacturerAddgene Plasmid #48234
-
Vector typeMammalian Expression ; PiggyBac
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVAPA
-
Alt nameVAMP-A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)883
-
GenBank IDNM_003574.6
-
Entrez GeneVAPA (a.k.a. VAMP-A, VAP-33, VAP-A, VAP33, hVAP-33)
- Promoter EF1a
-
Tag
/ Fusion Protein
- mKeima (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.06.26.546565v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAC150-KEIMA-VAPA was a gift from Wade Harper (Addgene plasmid # 212096 ; http://n2t.net/addgene:212096 ; RRID:Addgene_212096) -
For your References section:
Combinatorial selective ER-phagy remodels the ER during neurogenesis. Hoyer MJ, Capitanio C, Smith IR, Paoli JC, Bieber A, Jiang Y, Paulo JA, Gonzalez-Lozano MA, Baumeister W, Wilfling F, Schulman BA, Harper JW. Nat Cell Biol. 2024 Mar;26(3):378-392. doi: 10.1038/s41556-024-01356-4. Epub 2024 Mar 1. 10.1038/s41556-024-01356-4 PubMed 38429475