Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Talin1(ΔR1-12)-mCherry
(Plasmid #212008)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 212008 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3962
  • Total vector size (bp) 6881
  • Modifications to backbone
    N-terminal EGFP removed
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Talin1(ΔR1-12)-mCherry
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2919
  • GenBank ID
    CAA39588.1
  • Entrez Gene
    Tln1 (a.k.a. Tln)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry fluorescent protein (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer acgcaaatgggcggtagg
  • 3′ sequencing primer GATGAGTTTGGACAAACCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Talin1(ΔR1-12)-mCherry was a gift from Vesa Hytönen (Addgene plasmid # 212008 ; http://n2t.net/addgene:212008 ; RRID:Addgene_212008)
  • For your References section:

    Talin-mediated force transmission and talin rod domain unfolding independently regulate adhesion signaling. Rahikainen R, Ohman T, Turkki P, Varjosalo M, Hytonen VP. J Cell Sci. 2019 Apr 3;132(7):jcs226514. doi: 10.1242/jcs.226514. 10.1242/jcs.226514 PubMed 30837291