Talin1 head-mCherry
(Plasmid #212005)

• Purpose: Expression of mouse talin1 head (1-490)-mCherry in mammalian cells
• Depositing Lab: Vesa Hytönen
• Publication: Rahikainen et al J Cell Sci. 2019 Apr 3;132(7):jcs226514. doi: 10.1242/jcs.226514.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 3962
• Total vector size (bp): 6143
• Modifications to backbone: N-terminal EGFP removed
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Mouse talin1 head domain (1-490)
• Species: M. musculus (mouse)
• Insert Size (bp): 2181
• GenBank ID: CAA39588.1
• Entrez Gene: Tln1 (a.k.a. Tln)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry fluorescent protein (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: acgcaaatgggcggtagg
• 3′ sequencing primer: GATGAGTTTGGACAAACCAC

Resource Information

• Supplemental Documents:
  • Talin1 head-mCherry.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry