Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKLV2-U6gRNA5(MYC_2)-PGKpuroBFP-W
(Plasmid #211970)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 211970 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W
  • Backbone size w/o insert (bp) 8630
  • Total vector size (bp) 8650
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting MYC
  • gRNA/shRNA sequence
    TATTTCTACTGCGACGAGG
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_002467.6
  • Entrez Gene
    MYC (a.k.a. MRTL, MYCC, bHLHe39, c-Myc)
  • Promoter Human U6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer AGATAATTAGAATTAATTTGACTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKLV2-U6gRNA5(MYC_2)-PGKpuroBFP-W was a gift from Kosuke Yusa (Addgene plasmid # 211970 ; http://n2t.net/addgene:211970 ; RRID:Addgene_211970)
  • For your References section:

    RENGE infers gene regulatory networks using time-series single-cell RNA-seq data with CRISPR perturbations. Ishikawa M, Sugino S, Masuda Y, Tarumoto Y, Seto Y, Taniyama N, Wagai F, Yamauchi Y, Kojima Y, Kiryu H, Yusa K, Eiraku M, Mochizuki A. Commun Biol. 2023 Dec 28;6(1):1290. doi: 10.1038/s42003-023-05594-4. 10.1038/s42003-023-05594-4 PubMed 38155269