-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 21192 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneLZRS-RfA
- Backbone size w/o insert (bp) 11100
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsSTBL2
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMek2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1200
-
MutationKW71, constitutive active
-
Entrez GeneMAP2K2 (a.k.a. CFC4, MAPKK2, MEK2, MKK2, PRKMK2)
Cloning Information
- Cloning method Gateway Cloning
- 5′ cloning site attR (not destroyed)
- 3′ cloning site attR (not destroyed)
- 5′ sequencing primer TGGATACACGCCGCCCACGTG
- 3′ sequencing primer ATCGTCGACCACTGTGCTGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFrom Natalie G. Ahn, Mansour et. al. Cell Growth & Diff 1996; 7:243-250
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Constitutive active protein has the following aa sequence deleted - EQQKKRLE, residues 48 to 55.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LZRS-Mek2-KW71 (KW6) was a gift from Paul Khavari (Addgene plasmid # 21192 ; http://n2t.net/addgene:21192 ; RRID:Addgene_21192)