LZRS-Mek2-K101A (KA7)
(Plasmid
#21191)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21191 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLZRS-RfA
- Backbone size w/o insert (bp) 11100
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsSTBL2
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMek2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1200
-
MutationK101A (catalytically inactive)
-
Entrez GeneMAP2K2 (a.k.a. CFC4, MAPKK2, MEK2, MKK2, PRKMK2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TGGATACACGCCGCCCACGTG
- 3′ sequencing primer ATCGTCGACCACTGTGCTGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byJaffrey T. Holt, Abbott et. al.JBC 1999; 274:2732-2742
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LZRS-Mek2-K101A (KA7) was a gift from Paul Khavari (Addgene plasmid # 21191 ; http://n2t.net/addgene:21191 ; RRID:Addgene_21191)