Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

MTOR-F2108L_DARIC(1)_CD19-scFv_AAV6_Donor
(Plasmid #211905)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 211905 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC19
  • Total vector size (bp) 10784
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DARIC-CD19-scFv
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1251
  • Promoter hPGK1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GCGGCCTAAGCTTCCTGGAAG
  • 3′ sequencing primer GCGCTCGAGGGTACCCCTAGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Inverted terminal repeats (ITRs) integrity should be assessed via BssHII digestion after each transformation and plasmid purification.

Please visit https://doi.org/10.1101/2023.09.14.557485 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MTOR-F2108L_DARIC(1)_CD19-scFv_AAV6_Donor was a gift from Yannick Doyon (Addgene plasmid # 211905 ; http://n2t.net/addgene:211905 ; RRID:Addgene_211905)
  • For your References section:

    Pharmacological control of CAR T cells through CRISPR-driven rapamycin resistance. Levesque S, Carleton G, Duque V, Goupil C, Fiset J-P, Villeneuve S, Normandeau E, Morin G, Dumont N, Nelson BH, Laganière J, Boyle B, Lum JJ, Doyon Y. bioRxiv 2023.09.14.557485 10.1101/2023.09.14.557485