pcDNA3-hFCER1G-VenusFlag
(Plasmid
#211899)
-
PurposeExpressess human FCER1G in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211899 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFCER1G
-
Alt nameFCRG
-
SpeciesH. sapiens (human)
-
GenBank IDEntrez Gene ID: 2207
-
Entrez GeneFCER1G (a.k.a. FCRG)
-
Tag
/ Fusion Protein
- VenusFlag (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TCCGTGTTTCAGTTAGCCTCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byVector pDONR221-FCER1G was purchased from DNASU
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-hFCER1G-VenusFlag was a gift from Haian Fu (Addgene plasmid # 211899 ; http://n2t.net/addgene:211899 ; RRID:Addgene_211899)