pDEST-GST-hSYK
(Plasmid
#211892)
-
PurposeExpress human SYK in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211892 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDEST27
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSYK
-
Alt nameSpleen Associated Tyrosine Kinase, Spleen Tyrosine Kinase, Tyrosine-Protein Kinase SYK, EC 2.7.10.2, P72-Syk, EC 2.7.10, IMD82
-
SpeciesH. sapiens (human)
-
GenBank IDEntrez Gene ID: 6850
-
Entrez GeneSYK (a.k.a. IMD82, p72-Syk)
-
Tag
/ Fusion Protein
- GST tag (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GTAAAACGACGGCCAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byVector pDONR223-SYK was purchased from Addgene.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDEST-GST-hSYK was a gift from Haian Fu (Addgene plasmid # 211892 ; http://n2t.net/addgene:211892 ; RRID:Addgene_211892)