pKERep
(Plasmid
#211826)
-
PurposeMedium copy number protein expression plasmid, suitable for electroporation in C. necator. Containes eGFP as model protein.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211826 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKRep
- Backbone size w/o insert (bp) 2963
- Total vector size (bp) 3683
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions200 µg/mL Kanamycin for C. necator
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
Insert Size (bp)720
- Promoter T5
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gagccgtgttttctggacgatg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKERep was a gift from Anita Emmerstorfer-Augustin (Addgene plasmid # 211826 ; http://n2t.net/addgene:211826 ; RRID:Addgene_211826) -
For your References section:
CO(2)-based production of phytase from highly stable expression plasmids in Cupriavidus necator H16. Arhar S, Rauter T, Stolterfoht-Stock H, Lambauer V, Kratzer R, Winkler M, Karava M, Kourist R, Emmerstorfer-Augustin A. Microb Cell Fact. 2024 Jan 3;23(1):9. doi: 10.1186/s12934-023-02280-2. 10.1186/s12934-023-02280-2 PubMed 38172920