pFUW-VenusFlag-hCD44
(Plasmid #211824)

• Purpose: Express CD44 in mammalian cells
• Depositing Lab: Haian Fu
• Publication: Du et al J Biol Chem. 2023 Oct 20:105382. doi: 10.1016/j.jbc.2023.105382.

Backbone

• Vector backbone: pFUW
• Backbone manufacturer: 10000
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CD44
• Alt name: MIC4, MDU2, MDU3
• Species: H. sapiens (human)
• Mutation: isoform corresponds to UniProt ID P16070-1 with amino acid changes K374R and I436T consistent with ORFeome V8.1 source (doi: 10.1038/nmeth.1638)
• GenBank ID: NM_001001389.2
• Entrez Gene: CD44 (a.k.a. CDW44, CSPG8, ECM-III, ECMR-III, H-CAM, HCELL, HUTCH-1, HUTCH-I, Hermes-1, IN, LHR, MC56, MDU2, MDU3, MIC4, Pgp1)
• Tag / Fusion Protein:
  • N-Terminal Venus and Flag tags

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TGAAGCTCCGGTTTTGAACT
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: hORFeome V8.1 (doi: 10.1038/nmeth.1638), RNA interference (RNAi) Platform, Broad Institute of Harvard and Massachusetts Institute of Technology, Cambridge, Massachusetts, USA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is also included in the TREAT-AD Plasmid Collection (https://www.addgene.org/depositor-collections/treat-ad/).