pDEST27-GST-hMSN
(Plasmid
#211823)
-
PurposeExpress human MSN in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211823 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDEST27
-
Backbone manufacturerInvitrogen
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMSN
-
Alt nameMoesin, Membrane-Organizing Extension Spike Protein, Epididymis Luminal Protein 70, HEL70, IMD50
-
SpeciesH. sapiens (human)
-
GenBank IDEntrez Gene ID: 4478
-
Entrez GeneMSN (a.k.a. HEL70, IMD50)
-
Tag
/ Fusion Protein
- GST tag (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GTAAAACGACGGCCAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byVector pDONR221-MSN was purchased from DNASU
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDEST27-GST-hMSN was a gift from Haian Fu (Addgene plasmid # 211823 ; http://n2t.net/addgene:211823 ; RRID:Addgene_211823) -
For your References section:
Discovery of FERM domain protein-protein interaction inhibitors for MSN and CD44 as a potential therapeutic approach for Alzheimer's disease. Du Y, Bradshaw WJ, Leisner TM, Annor-Gyamfi JK, Qian K, Bashore FM, Sikdar A, Nwogbo FO, Ivanov AA, Frye SV, Gileadi O, Brennan PE, Levey AI, Axtman AD, Pearce KH, Fu H, Katis VL. J Biol Chem. 2023 Oct 20:105382. doi: 10.1016/j.jbc.2023.105382. 10.1016/j.jbc.2023.105382 PubMed 37866628