Skip to main content
Addgene

pDEST27-GST-hMSN
(Plasmid #211823)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 211823 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pDEST27
  • Backbone manufacturer
    Invitrogen
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MSN
  • Alt name
    Moesin, Membrane-Organizing Extension Spike Protein, Epididymis Luminal Protein 70, HEL70, IMD50
  • Species
    H. sapiens (human)
  • GenBank ID
    Entrez Gene ID: 4478
  • Entrez Gene
    MSN (a.k.a. HEL70, IMD50)
  • Tag / Fusion Protein
    • GST tag (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GTAAAACGACGGCCAG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Vector pDONR221-MSN was purchased from DNASU

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDEST27-GST-hMSN was a gift from Haian Fu (Addgene plasmid # 211823 ; http://n2t.net/addgene:211823 ; RRID:Addgene_211823)

  • For your References section:

    Discovery of FERM domain protein-protein interaction inhibitors for MSN and CD44 as a potential therapeutic approach for Alzheimer's disease. Du Y, Bradshaw WJ, Leisner TM, Annor-Gyamfi JK, Qian K, Bashore FM, Sikdar A, Nwogbo FO, Ivanov AA, Frye SV, Gileadi O, Brennan PE, Levey AI, Axtman AD, Pearce KH, Fu H, Katis VL. J Biol Chem. 2023 Oct 20:105382. doi: 10.1016/j.jbc.2023.105382. 10.1016/j.jbc.2023.105382 PubMed 37866628
Related items:
Commonly requested with: