Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEJS1983 Lenti-dead_GFP_ABE reporter-BlastR
(Plasmid #211820)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 211820 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lentiviral backbone
  • Backbone size w/o insert (bp) 7934
  • Total vector size (bp) 11015
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dead GFP reporter
  • Species
    Synthetic
  • Insert Size (bp)
    3076
  • Promoter CMV promoter and SV40 promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcgttgacattgattattgactag
  • 3′ sequencing primer ctgtggaatgtgtgtcagtta
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.03.20.533459 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEJS1983 Lenti-dead_GFP_ABE reporter-BlastR was a gift from Erik Sontheimer (Addgene plasmid # 211820 ; http://n2t.net/addgene:211820 ; RRID:Addgene_211820)
  • For your References section:

    Self-delivering, chemically modified CRISPR RNAs for AAV co-delivery and genome editing in vivo. Zhang H, Kelly K, Lee J, Echeverria D, Cooper D, Panwala R, Amrani N, Chen Z, Gaston N, Wagh A, Newby GA, Xie J, Liu DR, Gao G, Wolfe SA, Khvorova A, Watts JK, Sontheimer EJ. Nucleic Acids Res. 2023 Nov 30:gkad1125. doi: 10.1093/nar/gkad1125. 10.1093/nar/gkad1125 PubMed 38033325