Skip to main content
Addgene

pEJS1553 pLenti-U1a-SpCas9-miniU6-tracrRNA
(Plasmid #211819)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 211819 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lentiviral vector
  • Backbone size w/o insert (bp) 7918
  • Total vector size (bp) 13038
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SpCas9, tracrRNA and blasticidin resistance gene
  • Species
    Synthetic
  • Insert Size (bp)
    5120
  • Promoter U1a promoter and miniU6 promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATATCGAATTCTTAGCCCTCCCA
  • 3′ sequencing primer TAGCTAGCAAAAAAAGCACCGAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.03.20.533459 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEJS1553 pLenti-U1a-SpCas9-miniU6-tracrRNA was a gift from Erik Sontheimer (Addgene plasmid # 211819 ; http://n2t.net/addgene:211819 ; RRID:Addgene_211819)
  • For your References section:

    Self-delivering, chemically modified CRISPR RNAs for AAV co-delivery and genome editing in vivo. Zhang H, Kelly K, Lee J, Echeverria D, Cooper D, Panwala R, Amrani N, Chen Z, Gaston N, Wagh A, Newby GA, Xie J, Liu DR, Gao G, Wolfe SA, Khvorova A, Watts JK, Sontheimer EJ. Nucleic Acids Res. 2023 Nov 30:gkad1125. doi: 10.1093/nar/gkad1125. 10.1093/nar/gkad1125 PubMed 38033325