pKT-CNP
(Plasmid
#211803)
-
PurposeExpresses 2',3'-cyclic nucleotide phosphodiesterase catalytic domain
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211803 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepKT
- Backbone size w/o insert (bp) 3641
- Total vector size (bp) 4298
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name2',3'-cyclic nucleotide phosphodiesterase catalytic domain
-
Alt nameCNP
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)660
-
Entrez GeneCnp (a.k.a. CNPF, CNPI, CNPII, Cnp1)
- Promoter tet
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer ACCACTCCCTATCAGTGATA
- 3′ sequencing primer GTAAAACGACGGCCAGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKT-CNP was a gift from Emily Weinert (Addgene plasmid # 211803 ; http://n2t.net/addgene:211803 ; RRID:Addgene_211803) -
For your References section:
RNase I regulates Escherichia coli 2',3'-cyclic nucleotide monophosphate levels and biofilm formation. Fontaine BM, Martin KS, Garcia-Rodriguez JM, Jung C, Briggs L, Southwell JE, Jia X, Weinert EE. Biochem J. 2018 Apr 30;475(8):1491-1506. doi: 10.1042/BCJ20170906. 10.1042/BCJ20170906 PubMed 29555843