px552-U6-gRNA2-CMV-eGFP
(Plasmid
#211759)
-
PurposesgRNA2 targeting Exon 1 of VEGFA gene conserved across mouse, rhesus macaque, and human.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211759 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepx552
-
Backbone manufacturer(Addgene #60958)
-
Modifications to backboneReplaced the human synapsin (hSyn) promotor with a ubiquitous CMV promotor to drive GFP expression
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA2 targeting VEGF-A
-
SpeciesH. sapiens (human), M. musculus (mouse); M. mulatta (rhesus macaque)
-
Insert Size (bp)20
-
GenBank IDENSMMUG00000004577
-
Entrez GeneVEGFA (a.k.a. L-VEGF, MVCD1, VEGF, VPF)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SapI (unknown if destroyed)
- 3′ cloning site SapI (unknown if destroyed)
- 5′ sequencing primer GAGGGCCTATTTCCCATGAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px552-U6-gRNA2-CMV-eGFP was a gift from Glenn Yiu (Addgene plasmid # 211759 ; http://n2t.net/addgene:211759 ; RRID:Addgene_211759) -
For your References section:
CRISPR-based VEGF suppression using paired guide RNAs for treatment of choroidal neovascularization. Chung SH, Sin TN, Dang B, Ngo T, Lo T, Lent-Schochet D, Meleppat RK, Zawadzki RJ, Yiu G. Mol Ther Nucleic Acids. 2022 Apr 27;28:613-622. doi: 10.1016/j.omtn.2022.04.015. eCollection 2022 Jun 14. 10.1016/j.omtn.2022.04.015 PubMed 35614998