Skip to main content
Addgene

px552-U6-gRNA2-CMV-eGFP
(Plasmid #211759)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 211759 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    px552
  • Backbone manufacturer
    (Addgene #60958)
  • Modifications to backbone
    Replaced the human synapsin (hSyn) promotor with a ubiquitous CMV promotor to drive GFP expression
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA2 targeting VEGF-A
  • Species
    H. sapiens (human), M. musculus (mouse); M. mulatta (rhesus macaque)
  • Insert Size (bp)
    20
  • GenBank ID
    ENSMMUG00000004577
  • Entrez Gene
    VEGFA (a.k.a. L-VEGF, MVCD1, VEGF, VPF)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SapI (unknown if destroyed)
  • 3′ cloning site SapI (unknown if destroyed)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px552-U6-gRNA2-CMV-eGFP was a gift from Glenn Yiu (Addgene plasmid # 211759 ; http://n2t.net/addgene:211759 ; RRID:Addgene_211759)
  • For your References section:

    CRISPR-based VEGF suppression using paired guide RNAs for treatment of choroidal neovascularization. Chung SH, Sin TN, Dang B, Ngo T, Lo T, Lent-Schochet D, Meleppat RK, Zawadzki RJ, Yiu G. Mol Ther Nucleic Acids. 2022 Apr 27;28:613-622. doi: 10.1016/j.omtn.2022.04.015. eCollection 2022 Jun 14. 10.1016/j.omtn.2022.04.015 PubMed 35614998