px552-U6-gRNA1-CMV-eGFP
(Plasmid #211758)

• Purpose: sgRNA1 targeting Exon 1 of VEGFA gene conserved across mouse, rhesus macaque, and human.
• Depositing Lab: Glenn Yiu
• Publication: Chung et al Mol Ther Nucleic Acids. 2022 Apr 27;28:613-622. doi: 10.1016/j.omtn.2022.04.015. eCollection 2022 Jun 14.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: px552
• Backbone manufacturer: (Addgene #60958)
• Modifications to backbone: Replaced the human synapsin (hSyn) promotor with a ubiquitous CMV promotor to drive GFP expression
• Vector type: Mammalian Expression, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: gRNA1 targeting VEGF-A
• gRNA/shRNA sequence: CAGAAAGTTCATGGTTTCGG
• Species: H. sapiens (human), M. musculus (mouse); M. mulatta (rhesus macaque)
• GenBank ID: ENSMMUG00000004577
• Entrez Gene: VEGFA (a.k.a. L-VEGF, MVCD1, VEGF, VPF)
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SapI (unknown if destroyed)
• 3′ cloning site: SapI (unknown if destroyed)
• 5′ sequencing primer: GAGGGCCTATTTCCCATGAT

Resource Information

• Supplemental Documents:
  • px552-cmv-td-v1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry