Skip to main content
Addgene

pFB-MBD2.5R (pc2395)
(Plasmid #211727)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 211727 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFastBac1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4472
  • Vector type
    Insect Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MBD2.5 aa153-221
  • Alt name
    Mus musculus methyl-CpG binding domain protein 2
  • Species
    M. musculus (mouse)
  • Promoter Polyhedrin promotor
  • Tag / Fusion Protein
    • RFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site PspOMI (not destroyed)
  • 5′ sequencing primer AAATGATAACCATCTCGC
  • 3′ sequencing primer GTGTTGCTCCTGATGTGGTAGC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFB-MBD2.5R (pc2395) was a gift from Cristina Cardoso (Addgene plasmid # 211727 ; http://n2t.net/addgene:211727 ; RRID:Addgene_211727)
  • For your References section:

    Direct homo- and hetero-interactions of MeCP2 and MBD2. Becker A, Allmann L, Hofstatter M, Casa V, Weber P, Lehmkuhl A, Herce HD, Cardoso MC. PLoS One. 2013;8(1):e53730. doi: 10.1371/journal.pone.0053730. Epub 2013 Jan 15. 10.1371/journal.pone.0053730 PubMed 23335972