Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCF821-sgCIDE-4_U6-sgRNA-EF1a-mNeonGreen
(Plasmid #211664)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 211664 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCF821
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SpyCas9 and sgCIDE-4 guide RNA vector
  • gRNA/shRNA sequence
    CGCCTGTAATCCCAGCACTT

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCF821-sgCIDE-4_U6-sgRNA-EF1a-mNeonGreen was a gift from Christof Fellmann (Addgene plasmid # 211664 ; http://n2t.net/addgene:211664 ; RRID:Addgene_211664)
  • For your References section:

    Targeting the non-coding genome and temozolomide signature enables CRISPR-mediated glioma oncolysis. Tan IL, Perez AR, Lew RJ, Sun X, Baldwin A, Zhu YK, Shah MM, Berger MS, Doudna JA, Fellmann C. Cell Rep. 2023 Nov 28;42(11):113339. doi: 10.1016/j.celrep.2023.113339. Epub 2023 Nov 2. 10.1016/j.celrep.2023.113339 PubMed 37917583