lenti-ZWILCH gRNA1
(Plasmid
#211634)
-
PurposesgRNA-1 against ZWILCH
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211634 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLenti
- Backbone size w/o insert (bp) 8034
- Total vector size (bp) 8054
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA ZWILCH
-
gRNA/shRNA sequenceCCTAGCCAACAAGTACCTTC
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gactatcatatgcttaccgt (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lenti-ZWILCH gRNA1 was a gift from Agnel Sfeir (Addgene plasmid # 211634 ; http://n2t.net/addgene:211634 ; RRID:Addgene_211634) -
For your References section:
RHINO directs MMEJ to repair DNA breaks in mitosis. Brambati A, Sacco O, Porcella S, Heyza J, Kareh M, Schmidt JC, Sfeir A. Science. 2023 Aug 11;381(6658):653-660. doi: 10.1126/science.adh3694. Epub 2023 Jul 13. 10.1126/science.adh3694 PubMed 37440612