Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti-GFP-2A-Puro-gRAD1_A
(Plasmid #211544)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 211544 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti
  • Backbone size w/o insert (bp) 9544
  • Total vector size (bp) 9564
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA RAD1
  • gRNA/shRNA sequence
    TGTACTGATCATCCTCGTCT
  • Species
    Synthetic
  • Promoter U6

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-GFP-2A-Puro-gRAD1_A was a gift from Agnel Sfeir (Addgene plasmid # 211544 ; http://n2t.net/addgene:211544 ; RRID:Addgene_211544)
  • For your References section:

    RHINO directs MMEJ to repair DNA breaks in mitosis. Brambati A, Sacco O, Porcella S, Heyza J, Kareh M, Schmidt JC, Sfeir A. Science. 2023 Aug 11;381(6658):653-660. doi: 10.1126/science.adh3694. Epub 2023 Jul 13. 10.1126/science.adh3694 PubMed 37440612