Skip to main content
Addgene

pCW57.1 blast tBID-flag
(Plasmid #211533)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 211533 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCW57.1 blast
  • Backbone size w/o insert (bp) 5623
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tBID-flag
  • Alt name
    Truncated BID
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    450
  • Mutation
    Truncated (CASP8) form (p15)
  • Entrez Gene
    BID (a.k.a. FP497)
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AGTAGACGGCATCGCAGCTTGGATA
  • 3′ sequencing primer GGC GGA ATT TAC GTA GCG GCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57.1 blast tBID-flag was a gift from Richard Possemato (Addgene plasmid # 211533 ; http://n2t.net/addgene:211533 ; RRID:Addgene_211533)