pCW57.1 blast tBID-flag
(Plasmid
#211533)
-
PurposeExpresses truncated BID upon doxycycline addition to trigger apoptosis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211533 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCW57.1 blast
- Backbone size w/o insert (bp) 5623
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametBID-flag
-
Alt nameTruncated BID
-
SpeciesH. sapiens (human)
-
Insert Size (bp)450
-
MutationTruncated (CASP8) form (p15)
-
Entrez GeneBID (a.k.a. FP497)
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AGTAGACGGCATCGCAGCTTGGATA
- 3′ sequencing primer GGC GGA ATT TAC GTA GCG GCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57.1 blast tBID-flag was a gift from Richard Possemato (Addgene plasmid # 211533 ; http://n2t.net/addgene:211533 ; RRID:Addgene_211533)