Skip to main content
Addgene

pMXS-IRES-Blast coUGP2
(Plasmid #211531)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 211531 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMXS-IRES-BLAST
  • Backbone size w/o insert (bp) 5623
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    UGP2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1530
  • GenBank ID
    7360
  • Entrez Gene
    UGP2 (a.k.a. UDPG, UGPP2, UDPGP2, pHC379)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer AGTAGACGGCATCGCAGCTTGGATA
  • 3′ sequencing primer GGC GGA ATT TAC GTA GCG GCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXS-IRES-Blast coUGP2 was a gift from Richard Possemato (Addgene plasmid # 211531 ; http://n2t.net/addgene:211531 ; RRID:Addgene_211531)
  • For your References section:

    Glucose limitation protects cancer cells from apoptosis induced by pyrimidine restriction and replication inhibition. Nam M, Xia W, Mir AH, Jerrett A, Spinelli JB, Huang TT, Possemato R. Nat Metab. 2024 Dec;6(12):2338-2353. doi: 10.1038/s42255-024-01166-w. Epub 2024 Nov 26. 10.1038/s42255-024-01166-w PubMed 39592843