pLentiCRISPR-v2 sgUCK2
(Plasmid
#211522)
-
PurposeDeletes UCK2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211522 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLentiCRISPR-v2
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgUCK2
-
gRNA/shRNA sequenceAAGGAAGGGCTCGCCGCCGT
-
SpeciesSynthetic
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPR-v2 sgUCK2 was a gift from Richard Possemato (Addgene plasmid # 211522 ; http://n2t.net/addgene:211522 ; RRID:Addgene_211522) -
For your References section:
Glucose limitation protects cancer cells from apoptosis induced by pyrimidine restriction and replication inhibition. Nam M, Xia W, Mir AH, Jerrett A, Spinelli JB, Huang TT, Possemato R. Nat Metab. 2024 Dec;6(12):2338-2353. doi: 10.1038/s42255-024-01166-w. Epub 2024 Nov 26. 10.1038/s42255-024-01166-w PubMed 39592843