pLenti_Cas9_T2A_mNeonGreen_P2A_blasticidin
(Plasmid
#211471)
-
Purposelentiviral tricistronic complex expressing Cas9, mNeonGreen, and blasticidin resistance
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211471 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLentiCas9-T2A-GFP
-
Backbone manufacturerAddgene 78548
- Total vector size (bp) 13724
-
Modifications to backboneReplaced GFP with mNeonGreen
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9_T2A_mNeonGreen_P2A_BlasticidinR
-
SpeciesSynthetic
-
Insert Size (bp)5426
- Promoter hU6, EF-1a
-
Tag
/ Fusion Protein
- 3xFlag
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer agcagagagaagtttgttgc
- 3′ sequencing primer gggcagagcgcacatcgccc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bymNeonGreen was amplified from Addgene plasmid 122183
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.04.15.537042 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti_Cas9_T2A_mNeonGreen_P2A_blasticidin was a gift from James Eshleman (Addgene plasmid # 211471 ; http://n2t.net/addgene:211471 ; RRID:Addgene_211471) -
For your References section:
CRISPR-Cas9 for selective targeting of somatic mutations in pancreatic cancers. Teh SSK, Bowland K, Halper-Stromberg E, Kotwal A, Bennett A, Skaist A, Tang J, Cai F, Macoretta A, Liang H, Kamiyama H, Wheelan S, Lin MT, Hruban RH, Hung CF, Goldstein M, Scharpf RB, Roberts NJ, Eshleman JR. NAR Cancer. 2024 Jun 19;6(2):zcae028. doi: 10.1093/narcan/zcae028. eCollection 2024 Jun. 10.1093/narcan/zcae028 PubMed 38915758