pHAGE2-EF1a-HA-ATAD3A-IRES-Hygro
(Plasmid #211469)

• Purpose: Lentivirus backbone expressing ATAD3A with an HA-tag at the N-terminal
• Depositing Lab: Agnel Sfeir
• Publication: Fu et al Mol Cell. 2023 Oct 8:S1097-2765(23)00753-0. doi: 10.1016/j.molcel.2023.09.026.

Backbone

• Vector backbone: pHAGE2
• Backbone size w/o insert (bp): 8601
• Total vector size (bp): 10401
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ATAD3A
• Species: H. sapiens (human)
• Insert Size (bp): 1797
• Entrez Gene: ATAD3A (a.k.a. HAYOS, PHRINL)
• Promoter: EF-1a
• Tag / Fusion Protein:
  • HA (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH1 (not destroyed)
• 3′ cloning site: BmtI (not destroyed)
• 5′ sequencing primer: CGTCCAGGCACCTCGATTAG
• 3′ sequencing primer: TCGTCAAGAAGACAGGGCCA

Resource Information

• Supplemental Documents:
  • pHAGE2-EF1a-HA-ATAD3A-IRES-Hygro.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry