pHAGE2-EF1a-HA-ATAD3A-IRES-Hygro
(Plasmid
#211469)
-
PurposeLentivirus backbone expressing ATAD3A with an HA-tag at the N-terminal
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211469 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHAGE2
- Backbone size w/o insert (bp) 8601
- Total vector size (bp) 10401
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameATAD3A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1797
- Promoter EF-1a
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site BmtI (not destroyed)
- 5′ sequencing primer CGTCCAGGCACCTCGATTAG
- 3′ sequencing primer TCGTCAAGAAGACAGGGCCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE2-EF1a-HA-ATAD3A-IRES-Hygro was a gift from Agnel Sfeir (Addgene plasmid # 211469 ; http://n2t.net/addgene:211469 ; RRID:Addgene_211469) -
For your References section:
Mitochondrial DNA breaks activate an integrated stress response to reestablish homeostasis. Fu Y, Sacco O, DeBitetto E, Kanshin E, Ueberheide B, Sfeir A. Mol Cell. 2023 Oct 8:S1097-2765(23)00753-0. doi: 10.1016/j.molcel.2023.09.026. 10.1016/j.molcel.2023.09.026 PubMed 37832546