pcDNA3-ApaLI*-HA
(Plasmid #211461)

• Purpose: Express mitochondrial localized ApaLI with D211A, E225A and K227A mutations
• Depositing Lab: Agnel Sfeir
• Publication: Fu et al Mol Cell. 2023 Oct 8:S1097-2765(23)00753-0. doi: 10.1016/j.molcel.2023.09.026.

Backbone

• Vector backbone: pcDNA3
• Backbone size w/o insert (bp): 5530
• Total vector size (bp): 6702
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ApaLI mutant
• Insert Size (bp): 1172
• Mutation: D211A, E225A, K227A
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pcDNA3-ApaLI_-HA.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Ampicillin or Kanamycin may be used as bacterial resistance.