pcDNA3-ApaLID211A-HA
(Plasmid #211459)

• Purpose: Express mitochondrial localized ApaLI with D211A mutation
• Depositing Lab: Agnel Sfeir
• Publication: Fu et al Mol Cell. 2023 Oct 8:S1097-2765(23)00753-0. doi: 10.1016/j.molcel.2023.09.026.

Backbone

• Vector backbone: pcDNA3
• Backbone size w/o insert (bp): 5530
• Total vector size (bp): 6704
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ApaLI-D211A
• Insert Size (bp): 1172
• Mutation: D211A
• Promoter: CMV
• Tag / Fusion Protein:
  • HA (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pcDNA3-ApaLID211A-HA.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Ampicillin or Kanamycin may be used as bacterial resistance.