PB-mCherry-DMDEx23-eGFP
(Plasmid
#211366)
-
PurposePiggybac transposon plasmid for a DMD exon 23 skipping reporter (mCherry-DMDEx23)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211366 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePB-CAG-GFPd2 (Addgene #115665)
- Backbone size w/o insert (bp) 5592
- Total vector size (bp) 7632
-
Modifications to backboneCutting-out of GFPd2 (XmaI, NotI)
-
Vector typeMammalian Expression
-
Selectable markerseGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry-DMDEx23-eGFP
-
SpeciesDiscosoma sp. (mCherry), Aequorea victoria (eGFP)
-
Insert Size (bp)2040
-
MutationmCherry interrupted by mdx dystrophin exon 23 between nucleotide 105 and 106 flanked by intronic sequences. Donor splice site downstream of mdx exon 23 is based on the physiological donor splice site sequence of murine DMD intron 23.
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ATCCCGGGGACTCAGATCTCGAGGCCACCATG
- 3′ sequencing primer TCGCGGCCGCTTTACTTGTACAGCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-mCherry-DMDEx23-eGFP was a gift from Ulrich Lächelt (Addgene plasmid # 211366 ; http://n2t.net/addgene:211366 ; RRID:Addgene_211366) -
For your References section:
mCherry on Top: A Positive Read-Out Cellular Platform for Screening DMD Exon Skipping Xenopeptide-PMO Conjugates. Lessl AL, Pohmerer J, Lin Y, Wilk U, Hohn M, Horterer E, Wagner E, Lachelt U. Bioconjug Chem. 2023 Dec 20;34(12):2263-2274. doi: 10.1021/acs.bioconjchem.3c00408. Epub 2023 Nov 22. 10.1021/acs.bioconjchem.3c00408 PubMed 37991502