Skip to main content
Addgene

pBiT3.1-N_WDR62:1-1518
(Plasmid #211257)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 211257 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pBiT3.1-N
  • Backbone manufacturer
    Promega
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    WDR62:M1-H1518
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4569
  • Mutation
    isoform 4. L850S natural VAR_031299. Q1305L natural VAR_055015. G1370S natural VAR_031300. l1385F natural VAR_031301
  • Entrez Gene
    WDR62 (a.k.a. C19orf14, MCPH2)
  • Promoter CMV
  • Tag / Fusion Protein
    • MVSGWRLFKKISGSSGGSSG (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer T7
  • 3′ sequencing primer TTGCTCAGCGGTGGCAGCAG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Mammalian Gene Collection (WDR62)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note our next generation sequencing result identified a mixed nucleotide population that would affect amino acid 47 in the insert. Depositor confirms this does not affect function.

5' Cloning Site: Xho1 (not destroyed), 3' Cloning Site: Xba1 (not destroyed).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBiT3.1-N_WDR62:1-1518 was a gift from Cheryl Arrowsmith (Addgene plasmid # 211257 ; http://n2t.net/addgene:211257 ; RRID:Addgene_211257)

  • For your References section:

    A resource to enable chemical biology and drug discovery of WDR Proteins. Ackloo S, Li F, Szewczyk M, Seitova A, Loppnau P, Zeng H, Xu J, Ahmad S, Arnautova Y, Baghaie A, Beldar S, Bolotokova A, Centrella P, Chau I, Clark M, Cuozzo J, Dehghani-Tafti S, Disch J, Dong A, Dumas A, Feng J, Ghiabi P, Gibson E, Gilmer J, Goldman B, Green S, Guié M, Guilinger J, Harms N, Herasymenko O, Houliston S, Hutchinson A, Kearnes S, Keefe A, Kimani S, Kramer T, Kutera M, Kwak H, Lento C, Li Y, Liu J, Loup J, Machado R, Mulhern C, Perveen S, Righetto G, Riley P, Shrestha S, Sigel E, Silva M, Sintchak M, Slakman B, Taylor R, Thompson J, Torng W, Underkoffler C, Rechenberg M, Watson I, Wilson D, Wolf E, Yadav M, Yazdi A, Zhang J, Zhang Y, Santhakumar V, Edwards A, Barsyte-Lovejoy D, Schapira M, Brown P, Halabelian L, Arrowsmith C. bioRxiv 2024.03.03.583197 10.1101/2024.03.03.583197
Related items: