Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBiT3.1-N_DNAI1:1-699
(Plasmid #211201)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 211201 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBiT3.1-N
  • Backbone manufacturer
    Promega
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DNAI1:M1-T699
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2097
  • Mutation
    A8S Y202C P495Q annotated sequence conflicts
  • Entrez Gene
    DNAI1 (a.k.a. CILD1, DIC1, ICS1, PCD)
  • Promoter CMV
  • Tag / Fusion Protein
    • MVSGWRLFKKISGSSGGSSG (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer T7
  • 3′ sequencing primer TTGCTCAGCGGTGGCAGCAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Mammalian Gene Collection (BC030583)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' Cloning Site: Xho1 (not destroyed), 3' Cloning Site: Xba1 (not destroyed).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBiT3.1-N_DNAI1:1-699 was a gift from Cheryl Arrowsmith (Addgene plasmid # 211201 ; http://n2t.net/addgene:211201 ; RRID:Addgene_211201)
  • For your References section:

    A resource to enable chemical biology and drug discovery of WDR Proteins. Ackloo S, Li F, Szewczyk M, Seitova A, Loppnau P, Zeng H, Xu J, Ahmad S, Arnautova Y, Baghaie A, Beldar S, Bolotokova A, Centrella P, Chau I, Clark M, Cuozzo J, Dehghani-Tafti S, Disch J, Dong A, Dumas A, Feng J, Ghiabi P, Gibson E, Gilmer J, Goldman B, Green S, Guié M, Guilinger J, Harms N, Herasymenko O, Houliston S, Hutchinson A, Kearnes S, Keefe A, Kimani S, Kramer T, Kutera M, Kwak H, Lento C, Li Y, Liu J, Loup J, Machado R, Mulhern C, Perveen S, Righetto G, Riley P, Shrestha S, Sigel E, Silva M, Sintchak M, Slakman B, Taylor R, Thompson J, Torng W, Underkoffler C, Rechenberg M, Watson I, Wilson D, Wolf E, Yadav M, Yazdi A, Zhang J, Zhang Y, Santhakumar V, Edwards A, Barsyte-Lovejoy D, Schapira M, Brown P, Halabelian L, Arrowsmith C. bioRxiv 2024.03.03.583197 10.1101/2024.03.03.583197