Skip to main content
Addgene

pFBOH-MHL_EIF3I:1-325
(Plasmid #210910)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210910 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFBOH-MHL
  • Backbone manufacturer
    pFASTBac1 Modified
  • Vector type
    Insect Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EIF3I:M1-A325
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    975
  • Mutation
    wild type
  • Entrez Gene
    EIF3I (a.k.a. EIF3S2, PRO2242, TRIP-1, TRIP1, eIF3-beta, eIF3-p36)
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • MHHHHHHSSGRENLYFQG (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer tattccggattattcataccg
  • 3′ sequencing primer ctctacaaatgtggtatggc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Mammalian Gene Collection (BC000413)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' Cloning Site: BseRI (destroyed), 3' Cloning Site: BseRI (destroyed).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFBOH-MHL_EIF3I:1-325 was a gift from Cheryl Arrowsmith (Addgene plasmid # 210910 ; http://n2t.net/addgene:210910 ; RRID:Addgene_210910)
  • For your References section:

    A resource to enable chemical biology and drug discovery of WDR Proteins. Ackloo S, Li F, Szewczyk M, Seitova A, Loppnau P, Zeng H, Xu J, Ahmad S, Arnautova Y, Baghaie A, Beldar S, Bolotokova A, Centrella P, Chau I, Clark M, Cuozzo J, Dehghani-Tafti S, Disch J, Dong A, Dumas A, Feng J, Ghiabi P, Gibson E, Gilmer J, Goldman B, Green S, Guié M, Guilinger J, Harms N, Herasymenko O, Houliston S, Hutchinson A, Kearnes S, Keefe A, Kimani S, Kramer T, Kutera M, Kwak H, Lento C, Li Y, Liu J, Loup J, Machado R, Mulhern C, Perveen S, Righetto G, Riley P, Shrestha S, Sigel E, Silva M, Sintchak M, Slakman B, Taylor R, Thompson J, Torng W, Underkoffler C, Rechenberg M, Watson I, Wilson D, Wolf E, Yadav M, Yazdi A, Zhang J, Zhang Y, Santhakumar V, Edwards A, Barsyte-Lovejoy D, Schapira M, Brown P, Halabelian L, Arrowsmith C. bioRxiv 2024.03.03.583197 10.1101/2024.03.03.583197