pJM220-J23100-mNeongreen
(Plasmid
#210866)
-
PurposeTn7 insertion plasmid for Pseudomonas synxantha 2-79. Inserts mNeongreen driven by the J23100 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210866 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJM220
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemNeongreen
- Promoter J23100
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGTCGCCGCTAACATCGTAGACTAGTGGGTCTCAGGAG
- 3′ sequencing primer TGCTTAATTTCTCCTCTTTCCGCTACTAGTAGGTCTCTAGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJM220-J23100-mNeongreen was a gift from Richard Murray (Addgene plasmid # 210866 ; http://n2t.net/addgene:210866 ; RRID:Addgene_210866) -
For your References section:
Development of Cell-Free Transcription-Translation Systems in Three Soil Pseudomonads. Meyerowitz JT, Larsson EM, Murray RM. ACS Synth Biol. 2024 Feb 16;13(2):530-537. doi: 10.1021/acssynbio.3c00468. Epub 2024 Feb 6. 10.1021/acssynbio.3c00468 PubMed 38319019