pCS2-Prom1-TEVp-TwinStrep-His / IRES2 / Pcdh21-TEVp-Myc-Flag
(Plasmid #210820)

• Purpose: Mammalian overexpression vector for polycistronic co-expression of C-terminally Strep and His tagged human Prom1s1 (WT) and C-terminally Myc and Flag tagged human Pchd21 (WT)
• Depositing Lab: Luke Chao
• Publication: Bell et al Elife. 2024 Aug 13;13:e100061. doi: 10.7554/eLife.100061.

Backbone

• Vector backbone: pCS2
• Backbone manufacturer: Nathan D. Lawson
• Backbone size w/o insert (bp): 4736
• Total vector size (bp): 10226
• Modifications to backbone: IRES2 site added between upstream of the second insert to convert pCS2 into a polycistronic duet vector.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Prominin 1
• Alt name: PROM1
• Species: H. sapiens (human)
• Insert Size (bp): 2745
• Entrez Gene: PROM1 (a.k.a. AC133, CD133, CORD12, MCDR2, MSTP061, PROML1, RP41, STGD4)
• Promoter: CMV
• Tag / Fusion Protein:
  • TwinStrep, 10xHis (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CMV-F

Gene/Insert 2

• Gene/Insert name: Protocadherin 21
• Alt name: PCDH21
• Alt name: Cadherin-related family member 1
• Alt name: CDHR1
• Species: H. sapiens (human)
• Insert Size (bp): 2745
• Entrez Gene: CDHR1 (a.k.a. CORD15, PCDH21, PRCAD, RP65)
• Promoter: CMV / IRES2
• Tag / Fusion Protein:
  • Myc, 3xFlag (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGTGTTTAGTCGAGGTTAAAAAAACG

Resource Information

• Supplemental Documents:
  • pTAB-042_pCS2_DuetMCS_Pr1StrHis_Pc21Flag.gb
• A portion of this plasmid was derived from a plasmid made by: Modified version of construct from Noriaki Sasai (Nara Institute of Science and Technology).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2023.11.08.566258 for bioRxiv preprint.

Original construct published in: Hori, A., Nishide, K., Yasukuni, Y., Haga, K., Kakuta, W., Ishikawa, Y., Hayes, M.J., Ohnuma, S., Kiyonari, H., Kimura, K., et al. (2019). Prominin-1 Modulates Rho/ROCK-Mediated Membrane Morphology and Calcium-Dependent Intracellular Chloride Flux. Sci. Rep. 9, 15911. 10.1038/s41598-019-52040-9.