APCDD1-P2A-tdTomato
(Plasmid
#210801)
-
PurposeFluorescent reporter for APCDD1 expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210801 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepl552
- Backbone size w/o insert (bp) 5293
- Total vector size (bp) 8707
-
Modifications to backbonethe P2A-tdtomato-hGHPA sequence, flancked by APCDD1 left arm and right arm was inserted into the vector
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAPCDD1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3900
-
Entrez GeneAPCDD1 (a.k.a. B7323, DRAPC1, FP7019, HHS, HTS, HYPT1)
- Promoter endougeneous APCDD1 promoter
-
Tag
/ Fusion Protein
- tdtomato (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer accatgattacgccaagctc
- 3′ sequencing primer attcactggccgtcgtttta (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
APCDD1-P2A-tdTomato was a gift from Yuejun Chen (Addgene plasmid # 210801 ; http://n2t.net/addgene:210801 ; RRID:Addgene_210801) -
For your References section:
Mapping of clonal lineages across developmental stages in human neural differentiation. You Z, Wang L, He H, Wu Z, Zhang X, Xue S, Xu P, Hong Y, Xiong M, Wei W, Chen Y. Cell Stem Cell. 2023 Apr 6;30(4):473-487.e9. doi: 10.1016/j.stem.2023.02.007. Epub 2023 Mar 17. 10.1016/j.stem.2023.02.007 PubMed 36933556