APCDD1-P2A-tdTomato
(Plasmid #210801)

• Purpose: Fluorescent reporter for APCDD1 expression
• Depositing Lab: Yuejun Chen
• Publication: You et al Cell Stem Cell. 2023 Apr 6;30(4):473-487.e9. doi: 10.1016/j.stem.2023.02.007. Epub 2023 Mar 17.

Backbone

• Vector backbone: pl552
• Backbone size w/o insert (bp): 5293
• Total vector size (bp): 8707
• Modifications to backbone: the P2A-tdtomato-hGHPA sequence, flancked by APCDD1 left arm and right arm was inserted into the vector
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: APCDD1
• Species: H. sapiens (human)
• Insert Size (bp): 3900
• Promoter: endougeneous APCDD1 promoter
• Tag / Fusion Protein:
  • tdtomato (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: accatgattacgccaagctc
• 3′ sequencing primer: attcactggccgtcgtttta

Resource Information

• Supplemental Documents:
  • PL552 with hGHpA APCDD1-tdt-puro.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry