pKM427
(Plasmid #210788)

• Purpose: L5 integrating vector for delivery of defective Hyg gene (ZeoR) for oligonucleotide-mediated SNP transfer
• Depositing Lab: Kenan Murphy
• Publication: Murphy et al Methods Mol Biol. 2021;2314:301-321. doi: 10.1007/978-1-0716-1460-0_14.

Backbone

• Vector backbone: pDE43-MCZ
• Backbone manufacturer: Dirk Schnappinger
• Backbone size w/o insert (bp): 3592
• Total vector size (bp): 4818
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Bleocin (Zeocin), 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Defective hygromycin resistant gene
• Species: Synthetic
• Insert Size (bp): 1226
• Mutation: Changed hygromycin resistant gene W190 codon (TGG) to stop codon TAG.

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: PvuI (not destroyed)
• 5′ sequencing primer: CCTGGTATCTTTATAGTCCTGTCG
• 3′ sequencing primer: AATAGACCGGGACAAGGTTGCACC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Defective hygromycin-resistant gene was generated by overlap PCR and cloned into the PvuI-HindIII sites of pDE43-MCZ, a mycobacterial phage L5 integrating vector.